DNA Decoding 2.0

Decode this DNA strand :)

3....2.....1.... GO!

AGTTTACTAAACGTTGTCTGGGAACGTCTGAAGTGGAGTAGCCG

Lamarckism in Connection to Natural Selection

Jean-Baptiste Lamarck was one of the few that had the most influence over Darwin’s development of his theory of natural selection. Some scientists have argued to this day that Jean might have made a theory not necessarily relative to the idea behind natural selection.  However, when fully researching and gaining a better understanding of his idea often shows how it could relate to genetics and evolutional theory. Jean-Baptiste-Pierre-Antoine de Monet, chavalier de Lamarck was his full name and he was a pioneer French Biologist of his time period. He was born on the first of August 1744 and passed away on the 18^th of December 1829 in Paris, France.  He proposed the idea known as Lamarckism in which acquired characters are inheritable. Lamarckism was a continuation of Jean’s mentor’s work. Jean was credited for further developing the work of Count George-Louis Leclerc de Buffon.  He was the first to ever propose a type of method explaining how gradual changes of species came into place. Also extended the definition of change over time, where life started out simple and became complex over as life progressed. 

 

There’s two parts to Lamarckism in which Jean published Philosophie Zoologique  in 1809 describing in depth the two parts to the mechanism on how change was steadily  introduced into species and later passed on to the following generations. The very first part of Lamarckism is Use and Disuse or also known as the altering influence of particular circumstances (how the environment can affect gradation of a form). The example of the elongated neck of a giraffe is great in explaining the concept. Based on the theory, a giraffe is said to be able to develop an elongated neck after putting so much strain on it when reaching leaves on high branches. There is quite a downfall when it comes to this part because Jean never really fully explained how it was possible for such process to occur. This example has been used in order to explain how use can change a trait and how disuse would cause a trait to be reduced and thus become unnecessary.

The second part to it would be the in depth of the use and disuse method. That is the inheritance of acquired traits. Jean believed that the traits that were changed or would change through use could be passed down to its offspring. But this was only plausible if both parents underwent an acquiring of traits during their lifetime. However, if one individual who underwent acquiring of new traits mated with someone who simply disuse and reduced a trait then all the peculiarities that were acquired would then disappear and the offspring would not inherit such trait. This brought him to believe if two individuals of a species were both exposed to the same environment, they would equally respond and gain the same new habits. This is where the belief of exposure to new circumstances happened to all living organisms all over the world simply because it became subjective on every place on the earth’s surface. That is also due to the fact of the altering of climates, beds of rivers and oceans becoming displaced, some lands were elevated while others eroded and many various factors in which contributed to modifications of species. These modifications were indeed slow and incremental. They only happened if the changes of a circumstance caused the animal to adapt new habits. An extension explanation behind the idea of inheritance where evolutionary change occurs steadily but it is constant. This proposal came from his examination of seashells in which he noticed that as they aged the simpler they looked. That’s when he concluded that all species started out simple and as they gradually became older, they were constantly become more complex or in other words becoming their true perfect form.

If Jean-Baptiste had not proposed such idea of inheritance of acquired traits though he never really called it that, Charles Darwin would have not been able to develop his theory of natural selection. Charles Darwin took upon Jean-Baptiste’s idea and began to test it to see whether he could find how it was plausible that inheritance of acquired traits was one of the many plausible explanations of the theory of evolution. Jean might have proposed such a great explanation with lack of evidence backing such idea at a time where people didn’t put much attention to it but it Charles Darwin that fulfilled the theory. He provided an in depth explanation as to how characters acquired traits through use and disuse and how it was transmitted from generation to generation. All in all he gave more evidence of the effect of use and disuse. As he provided more examples to the idea of inheritance of acquired traits he never mentioned or credited Jean-Baptiste towards his idea.

Charles Darwin had credible evidence to further explain why he thought we all evolved over time. He had all the answers to how the environment affected and enhanced the way of living for every species. As well as the notion behind species first starting off as being simple and over time becoming more complex. But the mind-set of the main people from the church discouraged him from further publishing his work. The reason why the church was angered at such theory was because it went against the belief that god was the creator of all living species and the formation of the universe as it stated in the bible. Nonetheless, we all were granted with being able to learn about natural selection all thanks to another of Charles Darwin’s influences. That is Alfred Wallace. Thanks to him for motivating Charles in publish his theory despite of what the outcome might have been, we now have an in depth explanation of theory of evolution.

For in depth explanation on Lamarckism, the following links would be quite helpful.

NCBI    https://www.ncbi.nlm.nih.gov/pmc/articles/PMC3730912/

Encyclopedia Britannica   https://www.britannica.com/biography/Jean-Baptiste-Lamarck